CDS

Accession Number TCMCG077C04864
gbkey CDS
Protein Id KAF5730120.1
Location complement(join(8567419..8567484,8567971..8568060,8568156..8568308))
Organism Tripterygium wilfordii
locus_tag HS088_TW20G00490

Protein

Length 102aa
Molecule type protein
Topology linear
Data_file_division PLN
dblink BioProject:PRJNA542587, BioSample:SAMN11634134
db_source JAAARO010000020.1
Definition coatomer subunit epsilon-1 [Tripterygium wilfordii]
Locus_tag HS088_TW20G00490

EGGNOG-MAPPER Annotation

COG_category U
Description The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins
KEGG_TC -
KEGG_Module -
KEGG_Reaction -
KEGG_rclass -
BRITE ko00000        [VIEW IN KEGG]
ko04131        [VIEW IN KEGG]
ko04147        [VIEW IN KEGG]
KEGG_ko ko:K17268        [VIEW IN KEGG]
EC -
KEGG_Pathway -
GOs GO:0005575        [VIEW IN EMBL-EBI]
GO:0005622        [VIEW IN EMBL-EBI]
GO:0005623        [VIEW IN EMBL-EBI]
GO:0005737        [VIEW IN EMBL-EBI]
GO:0005773        [VIEW IN EMBL-EBI]
GO:0005774        [VIEW IN EMBL-EBI]
GO:0005794        [VIEW IN EMBL-EBI]
GO:0005798        [VIEW IN EMBL-EBI]
GO:0005829        [VIEW IN EMBL-EBI]
GO:0006810        [VIEW IN EMBL-EBI]
GO:0006888        [VIEW IN EMBL-EBI]
GO:0006890        [VIEW IN EMBL-EBI]
GO:0006891        [VIEW IN EMBL-EBI]
GO:0008150        [VIEW IN EMBL-EBI]
GO:0012505        [VIEW IN EMBL-EBI]
GO:0012506        [VIEW IN EMBL-EBI]
GO:0016020        [VIEW IN EMBL-EBI]
GO:0016192        [VIEW IN EMBL-EBI]
GO:0030117        [VIEW IN EMBL-EBI]
GO:0030120        [VIEW IN EMBL-EBI]
GO:0030126        [VIEW IN EMBL-EBI]
GO:0030135        [VIEW IN EMBL-EBI]
GO:0030137        [VIEW IN EMBL-EBI]
GO:0030659        [VIEW IN EMBL-EBI]
GO:0030660        [VIEW IN EMBL-EBI]
GO:0030662        [VIEW IN EMBL-EBI]
GO:0030663        [VIEW IN EMBL-EBI]
GO:0031090        [VIEW IN EMBL-EBI]
GO:0031410        [VIEW IN EMBL-EBI]
GO:0031982        [VIEW IN EMBL-EBI]
GO:0032991        [VIEW IN EMBL-EBI]
GO:0043226        [VIEW IN EMBL-EBI]
GO:0043227        [VIEW IN EMBL-EBI]
GO:0043229        [VIEW IN EMBL-EBI]
GO:0043231        [VIEW IN EMBL-EBI]
GO:0044422        [VIEW IN EMBL-EBI]
GO:0044424        [VIEW IN EMBL-EBI]
GO:0044425        [VIEW IN EMBL-EBI]
GO:0044431        [VIEW IN EMBL-EBI]
GO:0044433        [VIEW IN EMBL-EBI]
GO:0044437        [VIEW IN EMBL-EBI]
GO:0044444        [VIEW IN EMBL-EBI]
GO:0044446        [VIEW IN EMBL-EBI]
GO:0044464        [VIEW IN EMBL-EBI]
GO:0046907        [VIEW IN EMBL-EBI]
GO:0048193        [VIEW IN EMBL-EBI]
GO:0048475        [VIEW IN EMBL-EBI]
GO:0051179        [VIEW IN EMBL-EBI]
GO:0051234        [VIEW IN EMBL-EBI]
GO:0051641        [VIEW IN EMBL-EBI]
GO:0051649        [VIEW IN EMBL-EBI]
GO:0097708        [VIEW IN EMBL-EBI]
GO:0098588        [VIEW IN EMBL-EBI]
GO:0098796        [VIEW IN EMBL-EBI]
GO:0098805        [VIEW IN EMBL-EBI]

Sequence

CDS:  
ATGGCAGCACCAGACCAGCTCTTCTATCTGCGAAACAACTTCTACTTGGGTGCTTACCAAGCCGCGATCAACAACAGCGACCTCTCTCCGGAGGACGCCGTCGAGCGCGATTGCCTTGTCTACCGCTCTTACATTGCCCTCGGCAGCTACCAGCTTGTGATCAATGAGATCGACTCCTCGACTGCTACGCCTTTCCTAGCCGTGAAATTTCTTGCTCTCTATTTTTCCAGTCCTGATAATTGGGAATCAACAATTTCAAGCTTGAAGGAGTGGTTGAATGATTCAGCCATTGGAAGCAATCCTATTTAG
Protein:  
MAAPDQLFYLRNNFYLGAYQAAINNSDLSPEDAVERDCLVYRSYIALGSYQLVINEIDSSTATPFLAVKFLALYFSSPDNWESTISSLKEWLNDSAIGSNPI